Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3373920
End position: 3373952
Length: 33

DNA sequence
>NC_013441, from 3373920 to 3373952 (33 bp); Gordonia bronchialis DSM 43247 GGCGGAGATCAGACAGAGATCAGGCGCCGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3373940-3375331	Sequence	Gbro_3146 - glycyl-tRNA synthetase (Protein is coded in complementary strand; from 3375331 to 3373940)