Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 33669
End position: 33713
Length: 45

DNA sequence
>NC_013441, from 33669 to 33713 (45 bp); Gordonia bronchialis DSM 43247 GTAGCCGCCCTGCTGGTACTCGCCCTGCTGGTAGTCCCCCTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 32959-34260	Sequence	Gbro_0031 - forkhead-associated protein (Protein is coded in complementary strand; from 34260 to 32959)