Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3359467
End position: 3359496
Length: 30

DNA sequence
>NC_013441, from 3359467 to 3359496 (30 bp); Gordonia bronchialis DSM 43247 TATCGGTATCGGTATCGGTATCGGTATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3358668-3359513	Sequence	Gbro_3132 - hypothetical protein (Protein is coded in complementary strand; from 3359513 to 3358668)