Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3292525
End position: 3292569
Length: 45

DNA sequence
>NC_013441, from 3292525 to 3292569 (45 bp); Gordonia bronchialis DSM 43247 AGAAGTCCGAGCCGGCGAAGTCAGAGCCCGCGAAGTCGGAGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3291799-3293613	Sequence	Gbro_3074 - 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase