Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3228707
End position: 3228751
Length: 45

DNA sequence
>NC_013441, from 3228707 to 3228751 (45 bp); Gordonia bronchialis DSM 43247 CCCCGGTAGCTCGTATCCCGGTGGCTCGCATCACGGTGGCTCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3228659-3230371	Sequence	Gbro_3018 - cell division protein FtsW (Protein is coded in complementary strand; from 3230371 to 3228659)