Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3228488
End position: 3228511
Length: 24

DNA sequence
>NC_013441, from 3228488 to 3228511 (24 bp); Gordonia bronchialis DSM 43247 GGCGACGGCGTCGGCGACGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3227394-3228557	Sequence	Gbro_3017 - UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-UDP N- acetylglucosamine transferase (Protein is coded in complementary strand; from 3228557 to 3227394)