Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3221618
End position: 3221662
Length: 45

DNA sequence
>NC_013441, from 3221618 to 3221662 (45 bp); Gordonia bronchialis DSM 43247 CCACCGCGCAGATCGCCGCCGCGCAGATCAGCACCCCGCAGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3221225-3221992	Sequence	Gbro_3011 - hypothetical protein (Protein is coded in complementary strand; from 3221992 to 3221225)