Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3203609
End position: 3203633
Length: 25

DNA sequence
>NC_013441, from 3203609 to 3203633 (25 bp); Gordonia bronchialis DSM 43247 CGGCCCGGACCGGCCCCGCCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3203385-3204818	Sequence	Gbro_2994 - serine/threonine protein kinase-like protein (Protein is coded in complementary strand; from 3204818 to 3203385)