Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3184898
End position: 3184927
Length: 30

DNA sequence
>NC_013441, from 3184898 to 3184927 (30 bp); Gordonia bronchialis DSM 43247 CGGTGCCGGTGTCGGCGCGGGTGCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3184890-3185918	Sequence	Gbro_2980 - hypothetical protein (Protein is coded in complementary strand; from 3185918 to 3184890)