Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 3094897
End position: 3094920
Length: 24

DNA sequence
>NC_013441, from 3094897 to 3094920 (24 bp); Gordonia bronchialis DSM 43247 CGGTGGCGTTGGCGGTGTCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3093936-3095255	Sequence	Gbro_2892 - extracellular ligand-binding receptor (Protein is coded in complementary strand; from 3095255 to 3093936)