Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2703110
End position: 2703133
Length: 24

DNA sequence
>NC_013441, from 2703110 to 2703133 (24 bp); Gordonia bronchialis DSM 43247 CGACGACGACGATGACGATGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2701138-2706636	Sequence	Gbro_2521 - carbamoyl-phosphate synthase L chain ATP--binding protein