Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2390305
End position: 2390349
Length: 45

DNA sequence
>NC_013441, from 2390305 to 2390349 (45 bp); Gordonia bronchialis DSM 43247 GCCGGACCCGAATCGGCGGGACCCGAATCTGTCCGGCCCGAATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2390299-2390886	Sequence	Gbro_2250 - hypothetical protein (Protein is coded in complementary strand; from 2390886 to 2390299)