Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2364140
End position: 2364193
Length: 54

DNA sequence
>NC_013441, from 2364140 to 2364193 (54 bp); Gordonia bronchialis DSM 43247 GGCTGACCACCATACGGCGACTGGCCACCATGCGGCGGCTGACCGCCATACGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2363522-2364490	Sequence	Gbro_2227 - hypothetical protein (Protein is coded in complementary strand; from 2364490 to 2363522)