Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2349664
End position: 2349687
Length: 24

DNA sequence
>NC_013441, from 2349664 to 2349687 (24 bp); Gordonia bronchialis DSM 43247 CCCGGCCTCGGCCGCGGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2349494-2349754	Sequence	Gbro_2216 - HPr family phosphocarrier protein (Protein is coded in complementary strand; from 2349754 to 2349494)