Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2287914
End position: 2287937
Length: 24

DNA sequence
>NC_013441, from 2287914 to 2287937 (24 bp); Gordonia bronchialis DSM 43247 CGTCGACCTCGACGTGGACGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2287481-2288443	Sequence	Gbro_2154 - phosphoesterase RecJ domain-containing protein