Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2046093
End position: 2046137
Length: 45

DNA sequence
>NC_013441, from 2046093 to 2046137 (45 bp); Gordonia bronchialis DSM 43247 GTTGCCGACAGGTCAGTTGCCGACAGGTCAGTTGCAGAACGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2046084-2046581	Sequence	Gbro_1940 - MarR family transcriptional regulator (Protein is coded in complementary strand; from 2046581 to 2046084)