Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 2001421
End position: 2001450
Length: 30

DNA sequence
>NC_013441, from 2001421 to 2001450 (30 bp); Gordonia bronchialis DSM 43247 TCGGTGTCGGTGTCGGTGTCGGTGTCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2000947-2001945	Sequence	Gbro_1905 - hypothetical protein (Protein is coded in complementary strand; from 2001945 to 2000947)