Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1916799
End position: 1916843
Length: 45

DNA sequence
>NC_013441, from 1916799 to 1916843 (45 bp); Gordonia bronchialis DSM 43247 CCGGCACGTTCGACACCGTCAGGTTCGACACCGTCACGCTCCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1916676-1917053	Sequence	Gbro_1831 - hypothetical protein (Protein is coded in complementary strand; from 1917053 to 1916676)