Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1859499
End position: 1859534
Length: 36

DNA sequence
>NC_013441, from 1859499 to 1859534 (36 bp); Gordonia bronchialis DSM 43247 GTCGTCTTCGTCGTCGACGTCCTCATCGTCCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1858954-1860264	Sequence	Gbro_1782 - hypothetical protein (Protein is coded in complementary strand; from 1860264 to 1858954)