Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1814529
End position: 1814573
Length: 45

DNA sequence
>NC_013441, from 1814529 to 1814573 (45 bp); Gordonia bronchialis DSM 43247 GTTGCCGGTTCGGTCGGTGCCGGTTCGGTGGTGGCCGGTCGGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1814157-1815584	Sequence	Gbro_1741 - hypothetical protein (Protein is coded in complementary strand; from 1815584 to 1814157)