Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1665120
End position: 1665164
Length: 45

DNA sequence
>NC_013441, from 1665120 to 1665164 (45 bp); Gordonia bronchialis DSM 43247 TCGGCTCGGTTGCCGACGGTTCGGTTGCCGACGGTTCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1664921-1666387	Sequence	Gbro_1598 - esterase (Protein is coded in complementary strand; from 1666387 to 1664921)