Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 162723
End position: 162767
Length: 45

DNA sequence
>NC_013441, from 162723 to 162767 (45 bp); Gordonia bronchialis DSM 43247 GGTGTCTTCTTCGCCGGTGCCTTCTTGGCTGCCGCCTTCTTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 162306-162878	Sequence	Gbro_0147 - hypothetical protein (Protein is coded in complementary strand; from 162878 to 162306)