Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1587627
End position: 1587671
Length: 45

DNA sequence
>NC_013441, from 1587627 to 1587671 (45 bp); Gordonia bronchialis DSM 43247 CGGATCCTTCAGCGTCGGATCCTTCAGCGTCGGATCCTTCAGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1587666-1588535	Sequence	Gbro_1522 - hypothetical protein (Protein is coded in complementary strand; from 1588535 to 1587666)