Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1478763
End position: 1478816
Length: 54

DNA sequence
>NC_013441, from 1478763 to 1478816 (54 bp); Gordonia bronchialis DSM 43247 AGCCCGGAGGCGGGTAGTTGCCGGGGGGCGGGTAGTTACCCGGAGGCGGGTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1478693-1479517	Sequence	Gbro_1408 - large conductance mechanosensitive channel protein (Protein is coded in complementary strand; from 1479517 to 1478693)