Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1477853
End position: 1477906
Length: 54

DNA sequence
>NC_013441, from 1477853 to 1477906 (54 bp); Gordonia bronchialis DSM 43247 GGTCCGCCGTGGCCGCCAGGTCCGCCGTGGCCGCCAGGTCCACCGGGGCCGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1477609-1477947	Sequence	Gbro_1406 - hypothetical protein (Protein is coded in complementary strand; from 1477947 to 1477609)