Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 137237
End position: 137260
Length: 24

DNA sequence
>NC_013441, from 137237 to 137260 (24 bp); Gordonia bronchialis DSM 43247 ACGTCGGCGTCGACGTCACCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 136592-138046	Sequence	Gbro_0119 - glutamate synthase, NADH/NADPH small subunit