Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1344730
End position: 1344771
Length: 42

DNA sequence
>NC_013441, from 1344730 to 1344771 (42 bp); Gordonia bronchialis DSM 43247 AGTCGTCAGATCTCAGTCGTCAGATCTCAGTCGTCAGGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1344490-1344732	Sequence	Gbro_1286 - hypothetical protein
ORF... 1344771-1345403	Sequence	Gbro_1287 - DNA-3-methyladenine glycosylase (Protein is coded in complementary strand; from 1345403 to 1344771)