Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 1283689
End position: 1283733
Length: 45

DNA sequence
>NC_013441, from 1283689 to 1283733 (45 bp); Gordonia bronchialis DSM 43247 GATGGTGATGACGCCGAGGGTGATGTCGCCGCGGGTGATGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1283101-1283835	Sequence	Gbro_1224 - DSBA oxidoreductase (Protein is coded in complementary strand; from 1283835 to 1283101)