Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 119279
End position: 119314
Length: 36

DNA sequence
>NC_013441, from 119279 to 119314 (36 bp); Gordonia bronchialis DSM 43247 GACGGCGTCGAGGACGGCGCCGAAGCCGGCGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 118803-119366	Sequence	Gbro_0105 - hypothetical protein (Protein is coded in complementary strand; from 119366 to 118803)