Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 114607
End position: 114630
Length: 24

DNA sequence
>NC_013441, from 114607 to 114630 (24 bp); Gordonia bronchialis DSM 43247 CGCGGTCGCGGGCGAGGTCGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 114075-115361	Sequence	Gbro_0100 - cyclopropane-fatty-acyl-phospholipid synthase (Protein is coded in complementary strand; from 115361 to 114075)