Sequence retrieval

Genome: Gordonia bronchialis DSM 43247
Start position: 100415
End position: 100438
Length: 24

DNA sequence
>NC_013441, from 100415 to 100438 (24 bp); Gordonia bronchialis DSM 43247 GTCGAAGTCGACGTCGGAGTGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 98832-100598	Sequence	Gbro_0087 - Fis family transcriptional regulator (Protein is coded in complementary strand; from 100598 to 98832)