Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 512634
End position: 512678
Length: 45

DNA sequence
>NC_013411, from 512634 to 512678 (45 bp); Geobacillus sp. Y412MC61 CCGCTGTTGTTTGTTCCTTGGTTGTTTGTTCCTTGGTTGTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 512529-515234	Sequence	GYMC61_0511 - penicillin-binding protein (Protein is coded in complementary strand; from 515234 to 512529)