Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 3549316
End position: 3549359
Length: 44

DNA sequence
>NC_013411, from 3549316 to 3549359 (44 bp); Geobacillus sp. Y412MC61 AACGTATTTACAATGTATTGACGACGTATTTATGACGTATTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3548800-3549318	Sequence	GYMC61_3490 - transcriptional modulator of MazE/toxin MazF