Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 3504748
End position: 3504774
Length: 27

DNA sequence
>NC_013411, from 3504748 to 3504774 (27 bp); Geobacillus sp. Y412MC61 ACTCATCGTATTCATCGTATTCATCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3504534-3505091	Sequence	GYMC61_3447 - DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 3505091 to 3504534)