Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 3277947
End position: 3277982
Length: 36

DNA sequence
>NC_013411, from 3277947 to 3277982 (36 bp); Geobacillus sp. Y412MC61 TCGTGCCGATTTGCGTGCCGATGTCCGTGCGGATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3276878-3278473	Sequence	GYMC61_3228 flgK flagellar hook-associated protein FlgK (Protein is coded in complementary strand; from 3278473 to 3276878)