Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 3112498
End position: 3112521
Length: 24

DNA sequence
>NC_013411, from 3112498 to 3112521 (24 bp); Geobacillus sp. Y412MC61 CGCCGCCCCCGCCTCCGCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3111432-3112628	Sequence	GYMC61_3057 - extracellular ligand-binding receptor (Protein is coded in complementary strand; from 3112628 to 3111432)