Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 2975001
End position: 2975036
Length: 36

DNA sequence
>NC_013411, from 2975001 to 2975036 (36 bp); Geobacillus sp. Y412MC61 TCATTCCTTCCTTCATTCCTTCTTTCATTCCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2974898-2975182	Sequence	GYMC61_2918 - hypothetical protein (Protein is coded in complementary strand; from 2975182 to 2974898)