Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 2840104
End position: 2840139
Length: 36

DNA sequence
>NC_013411, from 2840104 to 2840139 (36 bp); Geobacillus sp. Y412MC61 CCTTGCTTCATCCCTTGCTTCATCCCTTGCTTTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2839975-2840997	Sequence	GYMC61_2786 - hypothetical protein (Protein is coded in complementary strand; from 2840997 to 2839975)