Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 2648098
End position: 2648121
Length: 24

DNA sequence
>NC_013411, from 2648098 to 2648121 (24 bp); Geobacillus sp. Y412MC61 ATGATGGTGATGATGATGGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2648096-2648923	Sequence	GYMC61_2615 - cobalamin (vitamin B12) biosynthesis CbiX protein (Protein is coded in complementary strand; from 2648923 to 2648096)