Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 1355466
End position: 1355489
Length: 24

DNA sequence
>NC_013411, from 1355466 to 1355489 (24 bp); Geobacillus sp. Y412MC61 TTCGCTTTTTCGCGTTTTCGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1355370-1355498	Sequence	GYMC61_1331 - hypothetical protein (Protein is coded in complementary strand; from 1355498 to 1355370)