Sequence retrieval

Genome: Geobacillus sp. Y412MC61
Start position: 1168883
End position: 1168909
Length: 27

DNA sequence
>NC_013411, from 1168883 to 1168909 (27 bp); Geobacillus sp. Y412MC61 CGGTGCTTGCGGCGCTTGCCGTGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1168049-1169506	Sequence	GYMC61_1154 gatA aspartyl/glutamyl-tRNA amidotransferase subunit A