Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 910518
End position: 910571
Length: 54

DNA sequence
>NC_013406, from 910518 to 910571 (54 bp); Geobacillus sp. Y412MC10 GTCCACCAGGACCTCCAGGACCACCAGGACCTCCGGGACCTCCGGGACCTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 910462-911229	Sequence	GYMC10_0775 - hypothetical protein (Protein is coded in complementary strand; from 911229 to 910462)