Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4811324
End position: 4811377
Length: 54

DNA sequence
>NC_013406, from 4811324 to 4811377 (54 bp); Geobacillus sp. Y412MC10 GCTCCCGTTGCACCTGTTACTCCCGTTTCTCCTGTTGTTCCCGTTGCACCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4811237-4813540	Sequence	GYMC10_4225 - collagen triple helix repeat-containing protein (Protein is coded in complementary strand; from 4813540 to 4811237)