Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 6299430
End position: 6299477
Length: 48

DNA sequence
>NC_013406, from 6299430 to 6299477 (48 bp); Geobacillus sp. Y412MC10 GGATCTACCGGCGGGTCTACTGGCGGATCCACCGGGGGATCTACCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6298344-6299747	Sequence	GYMC10_5618 - carbohydrate-binding family V/XII (Protein is coded in complementary strand; from 6299747 to 6298344)