Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4175696
End position: 4175740
Length: 45

DNA sequence
>NC_013406, from 4175696 to 4175740 (45 bp); Geobacillus sp. Y412MC10 CTTCGGTCGTTCCTGTTTCGGTTGTACCTGTTTCGTTGGTTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4173739-4175982	Sequence	GYMC10_3622 - copper amine oxidase domain-containing protein (Protein is coded in complementary strand; from 4175982 to 4173739)