Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 825674
End position: 825709
Length: 36

DNA sequence
>NC_013406, from 825674 to 825709 (36 bp); Geobacillus sp. Y412MC10 TTCTTTTTCTTGTTCTGTTTCTGTTTCTTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 818553-825821	Sequence	GYMC10_0698 - hypothetical protein (Protein is coded in complementary strand; from 825821 to 818553)