Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 5818734
End position: 5818769
Length: 36

DNA sequence
>NC_013406, from 5818734 to 5818769 (36 bp); Geobacillus sp. Y412MC10 AATCCTGGTCCAAAACCCGGTCCAAAGCCTGGTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5818713-5819057	Sequence	GYMC10_5144 - hypothetical protein (Protein is coded in complementary strand; from 5819057 to 5818713)