Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4875634
End position: 4875669
Length: 36

DNA sequence
>NC_013406, from 4875634 to 4875669 (36 bp); Geobacillus sp. Y412MC10 AGAAGCTCCTGCTGAAGCTCCAGCAGAAGCACCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4874520-4875692	Sequence	GYMC10_4286 - PpiC-type peptidyl-prolyl cis-trans isomerase