Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 4669083
End position: 4669118
Length: 36

DNA sequence
>NC_013406, from 4669083 to 4669118 (36 bp); Geobacillus sp. Y412MC10 TGGTCGTGGTCGTGGTTGTGGTTGTGGTCATGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4668771-4669841	Sequence	GYMC10_4092 - cobalamin synthesis protein P47K (Protein is coded in complementary strand; from 4669841 to 4668771)