Sequence retrieval

Genome: Geobacillus sp. Y412MC10
Start position: 3669881
End position: 3669916
Length: 36

DNA sequence
>NC_013406, from 3669881 to 3669916 (36 bp); Geobacillus sp. Y412MC10 GCTGCCACCACCGCTGCCACCACCACTGCCTCCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3668649-3672827	Sequence	GYMC10_3180 - coagulation factor 5/8 type domain-containing protein (Protein is coded in complementary strand; from 3672827 to 3668649)